NanoeBiroe - Sumpah Mati Cinta Mati [ Lirik - Chord/ Kunci Gitar ] Nanoe Biroe. Minab suba abulan Am Em. Beli setata nelponin Komang F G C G. Bilang peteng beli SMSin Komang C G . Ngorang good night Komang Am Em. Have a sweet dream, met bobok Komang
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCCCCCCCEmCCCCCCFCCCCCCGCCCCCCCCCCCCCCCCCEmCCCCCCFCCCCCCCGCCCCCCCAmCCCCCCCEmCCCCCCCFCCGCCCCCCCCCCGCAmCCCCCDCEmCCCCCCCFCCCCCCGCCCCCCCCCCCCCCEmCCCCCBmCCCAmCCCEmCCCFCCCCCCCCCCCECCCCCCCGCCCAmCCCEmCCCFCCCCCCCCCFmCCCDCACCCCCCCCmCCCCCCDCCCCCCCCECCCCCCCCCCCCCCCECCCCCCCFCCCCCCCGCCCCCCCCCCCCCCCECCCCCCCFCCCCCCCGCCCCCCCCCCCCCCCECCCCCCCFCCCCCCCGCCCCCCCAmCCCCCCCEmCCCCCCCFCCCGCCCCCCCCGCCACCCCCCCEmCCCCCCCFCCCCCCCCCCCCCCCCCCCCCCCAmCCCEmCCCFCCCCCCCCCFmCCCCCCCCCCCCCAmCCCEmCCCFCCCCCCGmCCCCCCCEmGCCCCCCCCCCCCCCAmCCCCCEmCCCFCCCCCCCCCCCCCCCCCCGCCCAmCCCEmCCCFCCCCCCCCCCCCCCCCCCCCEmCCACCCCEmCCFCCCCCCCGCCCCCCCCCCCEmCCCACCCCEmCCFCCCCCCCCCCCCCCCFmCCCCCCCCCCCCCEmCCCCCACFCCACCFCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
Berikutlirik dan chord kunci gitar lagu I Luh Sube Mati - Nanoe Biroe. Anggap beli i luh suba mati Sing ada di gumine. Berikut lirik dan chord kunci gitar lagu I Luh Sube Mati - Nanoe Biroe. Anggap beli i luh suba mati Sing ada di gumine. Rabu, 13 Juli 2022; Cari. Network. Tribunnews.com; TribunnewsWiki.com;
KunciGitar Nanoe Biroe - Menyama dan Lirik Lagu (Intro) Am C Am C Am C tusing merasa galah mejalan Am C mejalan nyalanang kehidupan Am C jani suba pada mekurenan Am C ngubu ditongos C rasa iraga menyama Dm asah asih asuh menyama Am nganti mati tetap menyama F ada ne sing berubah C rasa iraga menyama Dm jele melah enu menyama
KumpulanKunci Gitar Nanoe Biroe Terbaru dan Terupdate dengan Kunci Gitar dasar yang Mudah dimainkan untuk Pemula yang ingin belajar alat musik. Website yang berisi kumpulan chord (akord) / kunci gitar mudah dan dasar beserta lirik lagu indonesia maupun mancanegara.
ChordKunci Gitar dan Lirik Lagu Nanoe Biroe - Gumi Tanpa Matan Ai. Intro : G Em C D G. G. Minab mula saja seken. Em. Raos cinta memang gila. C. Buduh paling ragan Beli. D. Dot setate di sisin Adi. G. Lemah peteng. G. Beli pasti kal mati. Musik : G Emm C D G. Bridge : C D G. Minab tresnan Beli bas keliwat sujati
. 484 150 360 422 441 250 402 223
kunci gitar nanoe biroe iluh suba mati